Homologus and Analogous

 Homologus Trait

Monkey rib cage and human rib cage

1.      A.  I chose a monkey and a human for my homologus traits. My primary focus is the rib cage. The humans and monkey rib cages are practically the same in structure but shaped and curved a bit different. I believe these two share the homolugus trait because of their skeletal system.

B. The homologus trait I chose of both subjects are the skeletal system (like I described in part a) What I’m focusing on is their similar rib cage. Humans have 12 ribs and monkeys have 13 ribs which both have the same function which is to protect, support and respiration. It holds the lungs and heart and mainly protects the vital organs. Humans have a  barrel-shaped rib cage and monkeys have a funnel-shaped rib cage, meaning humans rib cages are more round and not flat and monkeys have a flat chest. I think that these traits exhibit differences because of their different posture. Monkeys can walk on all four which has made them slouch or have a hunch back type body when humans just walk on two feet.

C. The closest ancestor to share similar traits  to a human and monkey would be the homo antecessor. The homo antecessor goes back millions of years ago and have the same or similar body structure of a human and monkey. Which they also share similar genes/dna. They have the same skeletal system and its more similar t the human body than monkey. 

Analogous Trait

1.      A. The analogous traits ive chosen is the hand of a human and a the fin on a dolphin. They have different structures but practically the same bones needed for use. They both have phalanges, metacarpal, ulnas, and radius and humerus bones. Both have full function but with different bony structure that they both use on the daily.

B. The analogous trait of both species is the hand/fin. Like I said before the structures are completely different but serve the same purpose. They could both radiate up and down, side to side. Unlike humans dolphins can’t grab things or make a fist. Their structure is straight and humans have more range of motion. The fin is actually smaller but has 5 phalanges like the humans. Human’s humerus bones are longer than dolphins as well. The main point is that they both have similarities to the skeletal system (hand/fin). Primarily they both have the same bones needed to complete the structure but are different in size and shape and function or capabilities.

C. I believe that the ancestor for both the humans and dolphins could of shared the same traits. What I researched was that the mesonix has the same body structure of a dolphin which this animal goes back millions of years ago. Only thing was that this animal was on ground rather than water but they would spend most of their time by water and getting into the water. Their limbs then got smaller and attached more to the body which made it perfect for underwater movement. I think that these traits are analogous and not from common descent because humans evolved to walk upright and to use hand for many things when dolphins evolved to be in water and swim using their fins/back to move and have less functions on their fins. 

Molecular Genetics Assignment

TCAGTACGAAACTTATAACGTAAGTGTTAGCTGGATCTGAC

Thomas Malthus

I would argue that Thomas Malthus had the most influence on Charles Darwin development of his theory of natural selection. Thomas had a positive influence towards Charles because of a book that Thomas wrote which was called “Essay on the Principle of Evolution”. The books main concept is that the growth of population would always overcome the growth of food. Meaning struggle, disease and hunger would rise and affect the survival of the growing population. Charles was captivated by Thomas’s point of view of survival which he later used and applied his principle to his evolutionary system.

http://www.allaboutscience.org/thomas-malthus-faq.htm

Thomas’s contribution to the community was that he opened the door for Darwin to come up with the natural selection of organisms. Darwin saw that the strong and weak organisms were struggling for survival and that one would overcome causing evolution. What is preventing organisms from reproducing at their potential? (One of the points) I think this is directly towards Thomas Malthus principle of the population and survival because it’s talking about primary resources and how either the strong or the weak will survive. For both parties it comes back to habitat, food, and predators that’s preventing them from reproducing. In my opinion I think resources play a big role in reproducing even surviving which were both Charles and Thomas’s idea on natural selection. Populations could grow in environments if there were equal enough of resources that could sustain the organisms.

I don’t think Darwin would of came up with the theory of natural selection because without him reading the book Thomas had wrote he wouldn’t of been so fascinated by his principle of population. I believe that the book opened up Darwin’s mind about evolution and population, mainly when Thomas wrote about the organisms fighting for survival.

I think Darwin’s attitude stayed the same if anything he accepted the feedback and only made him feel more successful for taking credit of the natural selection theory. The book he published raised a lot of awareness and caused people to argue and go against or accept what he was stating. Many people from the church were against the book and though it was wrong the way he explained evolution. His book sold many copies and made him revise it for a second book, he persuaded many people and I’m sure he felt accomplished and did not really pay any attention of what the church though some people from the church were on the same page with Darwin.

The two items I would take with me would be my camera and a lighter because I would take that time to take photos of the island and after i feel that i have taken many photos I will start a fire to be saved from the desert island.